Variable Number Tandem Repeats (VNTRs)

Variable Number Tandem Repeats(VNTRs) are repeated sets of nucleotides present in the non-coding regions of DNA. For example, the sequence ATGATGATGATGATGATGATGATG contains the three-nucleotide sequence "ATG" eight times. The sequence being repeated is termed a motif. Repeats of 10-60 A T G A T G A T G A T G A T G A T G A T G A T G contains the three-nucleotide sequence A T G eight times. The sequence being repeated is termed a motif. Repeats of ten to sixty bases per repeat are known as minisatellites, where as shorter repeats, two to nine bases, are known as microsatellites (or STRs = Short Tandem Repeats).

The tandem repeated regions are present at many sites in the human genome, and differ in their number of repeats among individuals, this makes them useful molecular markers for population genetics, parentage assignment studies, and forensic science. The difference in the number of tandem repeats arise because of errors in the replication of genomic DNA. The DNA polymerase, when moving over a highly repetitive sequence, sometimes "hiccups," resulting either skipping an entire repeat or creating an extra repeat. This implies that the mutation rate in microsatellites with a high number of repeats is very high.